SimpleSearch - Line and FST details


Line specific information

 
Line ID 025H06
Vector Used pAC106
Line Availability available as T3 set from NASC (N402394)
Segregation Analysis 50:30:27
Confirmed for Hit At4g36860
Parent of DUPLO pair 12151
Parent of pair(s) none

Gene hit At4g36860

 
Sequence (A. th genome BLAST matches underlined) 
>48-K013722-022-025-H06-8409
TTGATCCATGTAGACTTTCCCTGACATCGAAGCCTTTACAATTGAATATATCCTCGAACG
ACAATACTTTTGCATCCAAACGGATGTGCCCTATACTCAATAAGACCAGCTGGATTTGTC
GGAATCTATGGGATCCTCCCTATAGTGAGAG
GenBank Accession AL762556 [GenBank]
Graphic View Graphic view of gene At4g36860
Predicted Position of Insertion Chr4:17359853 - go to primer design
BLAST e Value 2e-24
Hit Clone Code (BAC ID) AP22
Hit Gene Code At4g36860 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation LIM domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL762557 [GenBank]


Last Updated on 10.06.2021 13:37