SimpleSearch - Line and FST details


Line specific information

 
Line ID 028G04
Vector Used pAC106
Line Availability available as T3 set from NASC (N402668)
Segregation Analysis 50:18:14
Confirmed for Hit At5g60010
Parent of DUPLO pair none
Parent of pair(s) 5575, 72284, 72288, 72294, 72295

Gene hit At5g60010

 
Sequence (A. th genome BLAST matches underlined)
>31-K013763-022-028-G04-8409
CATCTCGTTCTCGTCCGGTGACTGTCCGATCAAGAGACCGTAAGCTCTGAAGTCCCCTAT
GGGATCCTCCCTATAGTGAGAGNNNNAANNCNNNANCNNTTTCTNATTGGAATCATAATG
AGAAGAGATGTTT
GenBank Accession AL762859 [GenBank]
Graphic View Graphic view of gene At5g60010
Predicted Position of Insertion Chr5:24160828 - go to primer design
BLAST e Value 3e-20
Hit Clone Code (BAC ID) MMN10
Hit Gene Code At5g60010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ferric reductase-like transmembrane component family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37