SimpleSearch - Line and FST details


Line specific information

 
Line ID 042F09
Vector Used pAC161
Line Availability available as T3 set from NASC (N404005)
Segregation Analysis 50:38:27
Confirmed for Hit At3g15470
Parent of DUPLO pair 2495
Parent of pair(s) none

Gene hit At3g15470

 
Sequence (A. th genome BLAST matches underlined) 
>70-K026602-022-042-F09-8409
CATTTACAATTGAATATGCTCGTAAGAGTTTGTGACTGTCACCTTCTTGTTGTTGTTACT
TCTGCTTGGTCCAGAAGCAGGGGATTCCTATGGGATCCTCCCTATAGTGAGACNTATTAN
TC
GenBank Accession CR395829 [GenBank]
Graphic View Graphic view of gene At3g15470
Predicted Position of Insertion Chr3:5217056 - go to primer design
BLAST e Value 3e-28
Hit Clone Code (BAC ID) MJK13
Hit Gene Code At3g15470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37