SimpleSearch - Line and FST details


Line specific information

 
Line ID 047E09
Vector Used pAC161
Line Availability available as T3 set from NASC (N404473)
Segregation Analysis 100:67:42
Confirmed for Hit At3g44320
Parent of DUPLO pair none
Parent of pair(s) 1279, 58696, 92408

Gene hit At3g44320

 
Sequence (A. th genome BLAST matches underlined) 
>69-K016081-022-047-E09-8409
TGTCATGTAGATTTCCCGGACATGAAGCCTTTTCGTTTTCGAATATCGACAGGGAAATCG
TTGCTGATATTGGATGGGAGAATAGGATGCCCCTCTACAGAACTGAATTGTACGCTATAG
GTCAGTTCTATGTTGTCATGCAGTATAGACATATACGAGCTTCGCAAGTAAAATTCTCTA
ACAATTATA
GenBank Accession AL936295 [GenBank]
Graphic View Graphic view of gene At3g44320
Predicted Position of Insertion Chr3:15994804 - go to primer design
BLAST e Value 8e-18
Hit Clone Code (BAC ID) T10D17
Hit Gene Code At3g44320 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nitrilase 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX942851 [GenBank] AL936295 [GenBank]


Last Updated on 10.06.2021 13:37