SimpleSearch - Line and FST details


Line specific information

 
Line ID 050A12
Vector Used pAC161
Line Availability available as T3 set from NASC (N404716)
Segregation Analysis 50:46:39
Confirmed for Hit At1g71170
Parent of DUPLO pair none
Parent of pair(s) 93636

Gene hit At1g71170

 
Sequence (A. th genome BLAST matches underlined) 
>89-K012138-022-050-A12-8409
NTGATCCATGTAGATTNTCCCGGACATGAANGCACTTACAATTGAATATATCCGGACATG
TAGATTTAGGATTTCAAGGCGTCGTCGATGTTATTAGGAGACTTAACGGCTTATCCTGAT
AAAACTATGGGATCCTCCCTATAGTGAGTCGTATTACTC
GenBank Accession AL753426 [GenBank]
Graphic View Graphic view of gene At1g71170
Predicted Position of Insertion Chr1:26831512 - go to primer design
BLAST e Value 8e-27
Hit Clone Code (BAC ID) F23N20
Hit Gene Code At1g71170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 6-phosphogluconate dehydrogenase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37