SimpleSearch - Line and FST details
Line specific information
Line ID | 058C10 |
Vector Used | pAC161 |
Line Availability | available as T3 set from NASC (N405506) |
Segregation Analysis | 50:45:41 |
Confirmed for Hit | At4g00295 |
Parent of DUPLO pair | none |
Parent of pair(s) | none |
Gene hit At4g00295
Sequence (A. th genome BLAST matches underlined) | >75-K016086-022-058-C10-8409 CGGTTTGTTTTTGGGAATATAGGATCCACTACGTCTATGGG |
GenBank Accession | AL936713 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr4:127876 - go to primer design |
BLAST e Value | 7e-12 |
Hit Clone Code (BAC ID) | F5I10 |
Hit Gene Code | At4g00295 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | fringe-like protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Other FSTs Supporting this Hit | AL936713 [GenBank] |
Last Updated on 10.06.2021 13:37 |