SimpleSearch - Line and FST details


Line specific information

 
Line ID 062D03
Vector Used pAC161
Line Availability available as T3 set from NASC (N405895)
Segregation Analysis 100:97:68
Confirmed for Hit At5g67540
Parent of DUPLO pair 12519
Parent of pair(s) none

Gene hit At5g67540

 
Sequence (A. th genome BLAST matches underlined) 
>20-K016100-022-062-D03-8409
TGTCCTGTNATTTCCCGGACATGAAGCCTTTACATTGAATATGGGAAAGAAAGATGTCGA
ATTGGTGACTTGTCGTCAAGAAACTCCTCAACGAGAGGGATCGGTTTTCTTGATCTCCGT
TTACTAGTACGAGGAGAACGCTTCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL936940 [GenBank]
Graphic View Graphic view of gene At5g67540
Predicted Position of Insertion Chr5:26945394 - go to primer design
BLAST e Value 3e-48
Hit Clone Code (BAC ID) K9I9
Hit Gene Code At5g67540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Arabinanase/levansucrase/invertase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37