SimpleSearch - Line and FST details


Line specific information

 
Line ID 066H12
Vector Used pAC161
Line Availability available as T3 set from NASC (N406336)
Segregation Analysis 100:100:95
Confirmed for Hit At2g27040
Parent of DUPLO pair none
Parent of pair(s) 3626, 3725, 9776

Gene hit At2g27040

 
Sequence (A. th genome BLAST matches underlined)
>24-K028182-022-066-H12t-8409
CCTTTAAATGGAAATATCCTGAATAGTGAACTTGATCAGATCATCGAGGTAGTTGAAACT
TCACAATAAAAGTTTCTCAGTGTAATTTTCTTCTTCTGTTAGTATGGGATCCTCCCTATA
GTGAGTCGTATTACTCAC
GenBank Accession FR802146 [GenBank]
Graphic View Graphic view of gene At2g27040
Predicted Position of Insertion Chr2:11537748 - go to primer design
BLAST e Value 4e-37
Hit Clone Code (BAC ID) T20P8
Hit Gene Code At2g27040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Argonaute family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37