SimpleSearch - Line and FST details


Line specific information

 
Line ID 087B10
Vector Used pAC161
Line Availability available as T3 set from NASC (N408278)
Segregation Analysis 100:99:81
Confirmed for Hit At3g16470
Parent of DUPLO pair none
Parent of pair(s) 96914, 96933, 96938, 96945

Gene hit At3g16470

 
Sequence (A. th genome BLAST matches underlined) 
>74-K012260-022-087-B10-8409
CTGATCCATGTAGATTTCCCGGACATCGAAGCCTTGTGCAAGTCGAATATATCCTGACCC
AAGCACAAACTGCACGTTTTGCAACAAAATTAAAGACTTTAGGTTTCTATGGGATCCTCC
CTATAGTGAGTCGTATTACTC
GenBank Accession BX572162 [GenBank]
Graphic View Graphic view of gene At3g16470
Predicted Position of Insertion Chr3:5596334 - go to primer design
BLAST e Value 3e-20
Hit Clone Code (BAC ID) T2O4
Hit Gene Code At3g16470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mannose-binding lectin superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX572163 [GenBank]


Last Updated on 10.06.2021 13:37