SimpleSearch - Line and FST details


Line specific information

 
Line ID 107A06
Vector Used pAC161
Line Availability available as T3 set from NASC (N410182)
Segregation Analysis 50:49:41
Confirmed for Hit At4g11220
Parent of DUPLO pair none
Parent of pair(s) 3942, 3967, 7205, 9880

Gene hit At4g11220

 
Sequence (A. th genome BLAST matches underlined) 
>41-K012377-022-107-A06-8409
NTTGGATCCATGTAGATTCTCCCTTTACATGAAGCCTTTACAATTGAANTATATCCTGAA
ATAAGAATCCTATCATCAATAACTACAAGAATCTCACAAGATCATTATACACATTTCCAA
AAAAAAAAAAATAATTCCCTTCCAAATTTTTTTAAAACTGTGAGACCCCCCTTTTGGGGG
GGGGTT
GenBank Accession AL756230 [GenBank]
Graphic View Graphic view of gene At4g11220
Predicted Position of Insertion Chr4:6839046 - go to primer design
BLAST e Value 2e-21
Hit Clone Code (BAC ID) F8L21
Hit Gene Code At4g11220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation VIRB2-interacting protein 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL756230 [GenBank]


Last Updated on 10.06.2021 13:37