SimpleSearch - Line and FST details


Line specific information

 
Line ID 110B11
Vector Used pAC161
Line Availability available as T3 set from NASC (N410487)
Segregation Analysis 50:46:39
Confirmed for Hit At4g25030
Parent of DUPLO pair 2292
Parent of pair(s) none

Gene hit At4g25030

 
Sequence (A. th genome BLAST matches underlined) 
>82-K030265-022-110-B11-8409
TTCCCTCTGATGAAACTCCGGCAAATTGCATCTGATCTGCTTCAACAGAAGACGGATTTG
GTATGGGATCCTCCCTATAGTGAGTCGTATTACTCACCTGCCTTTTANATTACCCCTTCN
NACATCTCNATTTTCCCTTCCANAAAAGACTTCAATTCAATCTTTCTTTT
GenBank Accession CR934541 [GenBank]
Graphic View Graphic view of gene At4g25030
Predicted Position of Insertion Chr4:12866582 - go to primer design
BLAST e Value 3e-25
Hit Clone Code (BAC ID) F13M23
Hit Gene Code At4g25030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Serine/Threonine-kinase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR803230 [GenBank] AL756521 [GenBank]


Last Updated on 10.06.2021 13:37