SimpleSearch - Line and FST details


Line specific information

 
Line ID 112B10
Vector Used pAC161
Line Availability available as T3 set from NASC (N410678)
Segregation Analysis 50:50:47
Confirmed for Hit At3g12320
Parent of DUPLO pair 11903
Parent of pair(s) none

Gene hit At3g12320

 
Sequence (A. th genome BLAST matches underlined)
>74-K014766-022-112-B10-8409
TGTAGATTGTGCGCAGCAGTAGATATGATCTGTACCTGTTTCCATACCATAATCATATCT
ATGGGATCCTCCCTATAGTGAGAA
GenBank Accession AL756709 [GenBank]
Graphic View Graphic view of gene At3g12320
Predicted Position of Insertion Chr3:3925014 - go to primer design
BLAST e Value 1e-07
Hit Clone Code (BAC ID) F28J15
Hit Gene Code At3g12320 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37