SimpleSearch - Line and FST details


Line specific information

 
Line ID 122H12
Vector Used pAC161
Line Availability available as T3 set from NASC (N411712)
Segregation Analysis 50:11:7
Confirmed for Hit At3g17920
Parent of DUPLO pair 11805
Parent of pair(s) none

Gene hit At3g17920

 
Sequence (A. th genome BLAST matches underlined)
>96-K028831-022-122-H12-8409
ANGNAGCCATTTACATTGAATATATCCCGCTAGTTGAGCCAGAAGAGCGGAACGGCCATC
TGATCCACGGGCATCCGATCCGCCCCATTGTGAGCCTTATTACTCGCAGGCGTACTCCCC
ACTCCCGGCTCTATGCCGCCGCGGACGATGCTTCTTCCTCCCCCTATTTCTCCCTTGACT
CACGCTGCTCCATCTCCGACATATTTGAGATGGTAACGAGTTTGTTTATTCTTTCCCTTT
CTCTCGCTTATGTCAGTTTTTTAGGGGCAANTTGGGGTGTTANCCA
GenBank Accession CR934666 [GenBank]
Graphic View Graphic view of gene At3g17920
Predicted Position of Insertion Chr3:6141550 - go to primer design
BLAST e Value 3e-53
Hit Clone Code (BAC ID) MEB5
Hit Gene Code At3g17920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Outer arm dynein light chain 1 protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR934666 [GenBank]


Last Updated on 10.06.2021 13:37