SimpleSearch - Line and FST details


Line specific information

 
Line ID 124D02
Vector Used pAC161
Line Availability available as T3 set from NASC (N411846)
Segregation Analysis 50:30:24
Confirmed for Hit At5g17730
Parent of DUPLO pair none
Parent of pair(s) 3739, 9831, 95055, 95060, 95064, 95068

Gene hit At5g17730

 
Sequence (A. th genome BLAST matches underlined)
>12-K012813-022-124-D02-8409
CACATAGGATCCAAGTATTGGTTGCAAGCATTTCATGATGATTTATAAATTAATACTATG
GAATCCTCCCTATAGTGAGTCGTATTACTC
GenBank Accession AL764326 [GenBank]
Graphic View Graphic view of gene At5g17730
Predicted Position of Insertion Chr5:5852944 - go to primer design
BLAST e Value 2e-24
Hit Clone Code (BAC ID) MVA3
Hit Gene Code At5g17730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL764326 [GenBank]


Last Updated on 10.06.2021 13:37