SimpleSearch - Line and FST details
Line specific information
| Line ID | 125A01 |
| Vector Used | pAC161 |
| Line Availability | available as T3 set from NASC (N411905) |
| Segregation Analysis | 50:45:35 |
| Confirmed for Hit | At1g31760 |
| Parent of DUPLO pair | 2502 |
| Parent of pair(s) | none |
Gene hit At1g31760
| Sequence (A. th genome BLAST matches underlined) | >01-K104603-0022-125-A01-8409 ATCCTGATCAAGAGAAACAAACAACGACTATGGGATCCTCCCTATAGTGAGTCGTATTAC TCA |
| GenBank Accession | FR803542 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr1:11373429 - go to primer design |
| BLAST e Value | 0.032 |
| Hit Clone Code (BAC ID) | F27M3 |
| Hit Gene Code | At1g31760 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | SWIB/MDM2 domain superfamily protein |
| Insertion Classification | TS2TE (5') |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | FR803542 [GenBank] |
|
Last Updated on 10.06.2021 13:37 |
gabi-kat.de 
