SimpleSearch - Line and FST details
Line specific information
Line ID | 125A01 |
Vector Used | pAC161 |
Line Availability | available as T3 set from NASC (N411905) |
Segregation Analysis | 50:45:35 |
Confirmed for Hit | At1g31760 |
Parent of DUPLO pair | 2502 |
Parent of pair(s) | none |
Gene hit At1g31760
Sequence (A. th genome BLAST matches underlined) | >01-K104603-0022-125-A01-8409 ATCCTGATCAAGAGAAACAAACAACGACTATGGGATCCTCCCTATAGTGAGTCGTATTAC TCA |
GenBank Accession | FR803542 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr1:11373429 - go to primer design |
BLAST e Value | 0.032 |
Hit Clone Code (BAC ID) | F27M3 |
Hit Gene Code | At1g31760 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | SWIB/MDM2 domain superfamily protein |
Insertion Classification | TS2TE (5') |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Other FSTs Supporting this Hit | FR803542 [GenBank] |
Last Updated on 10.06.2021 13:37 |