SimpleSearch - Line and FST details


Line specific information

 
Line ID 135B06
Vector Used pAC161
Line Availability available as T3 set from NASC (N412882)
Segregation Analysis 100:61:59
Confirmed for Hit At4g37250
Parent of DUPLO pair none
Parent of pair(s) 3102, 3304

Gene hit At4g37250

Sequence (A. th genome BLAST matches underlined)
>42-K012755-022-135-B06-8409
TTCGCACGTGGGCTGGCTTATCTCCACGAGAAGAAGCATGTGCATGGAAACTTGAAGCCT
ATGGGATCCTCCCTATAGTGAG
GenBank Accession AL765115 [GenBank]
Graphic View Graphic view of gene At4g37250
Predicted Position of Insertion Chr4:17528532 - go to primer design
BLAST e Value 2e-24
Hit Clone Code (BAC ID) AP22
Hit Gene Code At4g37250 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details