SimpleSearch - Line and FST details


Line specific information

 
Line ID 177A09
Vector Used pAC161
Line Availability available as T3 set from NASC (N416905)
Segregation Analysis 50:46:27
Confirmed for Hit At1g24470
Parent of DUPLO pair none
Parent of pair(s) 517

Gene hit At1g24470

 
Sequence (A. th genome BLAST matches underlined)
>65-K013519-022-177-A09-8409
TAGACTGAAGTGTTGTTCGAAAAACGACAACTACATTTTTACTTTGAAAGCGAAATAGTA
GTTTTCCTTTTATTGCATAAATATTACTACTG
GenBank Accession AL771060 [GenBank]
Graphic View Graphic view of gene At1g24470
Predicted Position of Insertion Chr1:8675602 - go to primer design
BLAST e Value 1e-16
Hit Clone Code (BAC ID) F21J9
Hit Gene Code At1g24470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation beta-ketoacyl reductase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37