SimpleSearch - Line and FST details


Line specific information

 
Line ID 179B10
Vector Used pAC161
Line Availability available as T3 set from NASC (N417110)
Segregation Analysis 50:49:38
Confirmed for Hit At5g15630
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g15630

 
Sequence (A. th genome BLAST matches underlined) 
>74-K013563-022-179-B10-8409
AAACCAACCATTGAATGACTAATAACATTCTTAAATCTTTTTGATACAGATGATACTGGA
ATGTTCTATGGAACGAAGTTTTACAATGATTTATTAATGGAAGCTGGACCTTCAGGGAAT
GTGCAATCAGAGGTTTTGCTACAGAAAGATCAAAAGACTTTTACTTTCAAGCAAGGTTGG
GCTTTTCCTAGGGGATCCT
GenBank Accession AL771315 [GenBank]
Graphic View Graphic view of gene At5g15630
Predicted Position of Insertion Chr5:5086211 - go to primer design
BLAST e Value 8e-104
Hit Clone Code (BAC ID) F14F8
Hit Gene Code At5g15630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation COBRA-like extracellular glycosyl-phosphatidyl inositol-anchored protein family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL771315 [GenBank]


Last Updated on 10.06.2021 13:37