SimpleSearch - Line and FST details


Line specific information

 
Line ID 181H05
Vector Used pAC161
Line Availability available as T3 set from NASC (N417369)
Segregation Analysis 100:98:78
Confirmed for Hit At1g60920
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g60920

 
Sequence (A. th genome BLAST matches underlined) 
>40-K013612-022-181-H05-8409
TGAAACAACCCATTATGGAAATTTTCTTAATAGAGAATGAATCAATAATGTAAAAAGTTG
AGATATGGGAAGAGAGTTCGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL771632 [GenBank]
Graphic View Graphic view of gene At1g60920
Predicted Position of Insertion Chr1:22430460 - go to primer design
BLAST e Value 4e-35
Hit Clone Code (BAC ID) T7P1
Hit Gene Code At1g60920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 55
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37