SimpleSearch - Line and FST details


Line specific information

 
Line ID 187A10
Vector Used pAC161
Line Availability available as T3 set from NASC (N417866)
Segregation Analysis 50:44:36
Confirmed for Hit At4g23580
Parent of DUPLO pair none
Parent of pair(s) 9534, 94939

Gene hit At4g23580

 
Sequence (A. th genome BLAST matches underlined) 
>73-K014619-022-187-A10-8409
TTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTCTTTTTCTTGTAAGTCACATCTT
TTTCATCAGACTTCACATAGACGGTTCCTTGATAACTTACGCTTAAGTACTCAGAGCCTT
TGCATATCTCCTCGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL759421 [GenBank]
Graphic View Graphic view of gene At4g23580
Predicted Position of Insertion Chr4:12304668 - go to primer design
BLAST e Value 2e-46
Hit Clone Code (BAC ID) F9D16
Hit Gene Code At4g23580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Galactose oxidase/kelch repeat superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37