SimpleSearch - Line and FST details


Line specific information

 
Line ID 195B09
Vector Used pAC161
Line Availability available as T3 set from NASC (N418645)
Segregation Analysis 50:36:34
Confirmed for Hit At2g35155
Parent of DUPLO pair none
Parent of pair(s) 1101, 75889

Gene hit At2g35155

 
Sequence (A. th genome BLAST matches underlined) 
>66-K014696-022-195-B09-8409
TGATCCTGTAGATTTCCCGAACATGAAGCCTTTACAATTGATATCTACATATTGGTACTG
CGGTTGGGTTTCGGATCCGCCGTGGTGTTCAACGAATGTTCCAGCGATACTNNGTCTTGT
TGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL760225 [GenBank]
Graphic View Graphic view of gene At2g35155
Predicted Position of Insertion Chr2:14820957 - go to primer design
BLAST e Value 5e-19
Hit Clone Code (BAC ID) T4C15
Hit Gene Code At2g35155 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Trypsin family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37