SimpleSearch - Line and FST details


Line specific information

 
Line ID 197E08
Vector Used pAC161
Line Availability available as T3 set from NASC (N418872)
Segregation Analysis 100:76:58
Confirmed for Hit At1g61140
Parent of DUPLO pair 11818
Parent of pair(s) none

Gene hit At1g61140

 
Sequence (A. th genome BLAST matches underlined) 
>61-K014719-022-197-E08-8409
TAAAATAATGACTAACTTGCATAATATTCTGAAGAAACTACCGCCATTCTCATAGCTATG
GGATCCTGCCTATGAGTGAGCCGTGCGATAATGACTTCTGTTCAACCACCCAAACGTCGG
AAAGCCTGACGACGGAGCAGCATTCCAAAAAGATCCCTTGGCTCGTCTGGGTCGGCTATG
GGATCCTC
GenBank Accession BX890873 [GenBank]
Graphic View Graphic view of gene At1g61140
Predicted Position of Insertion Chr1:22538570 - go to primer design
BLAST e Value 1e-07
Hit Clone Code (BAC ID) F11P17
Hit Gene Code At1g61140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX890873 [GenBank]


Last Updated on 10.06.2021 13:37