SimpleSearch - Line and FST details


Line specific information

 
Line ID 197G12
Vector Used pAC161
Line Availability available as T3 set from NASC (N418900)
Segregation Analysis 50:37:30
Confirmed for Hit At1g11190
Parent of DUPLO pair none
Parent of pair(s) 3697, 3729, 7145, 83982

Gene hit At1g11190

 
Sequence (A. th genome BLAST matches underlined) 
>95-K014720-022-197-G12-8409
TGATNATGAGAATCCCCTGGTTTTAATCCGGCGTGGATTTTGTATTGATTTTTTGGTTAA
CTCCGGTTAGCATAATTATAAAACGGATTAAGGTTATCTGAAAATGTCTCGGGTGGGACT
ACCTTTGGGATCCT
GenBank Accession AL760471 [GenBank]
Graphic View Graphic view of gene At1g11190
Predicted Position of Insertion Chr1:3751972 - go to primer design
BLAST e Value 5e-25
Hit Clone Code (BAC ID) T28P6
Hit Gene Code At1g11190 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation bifunctional nuclease i
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL760471 [GenBank]


Last Updated on 10.06.2021 13:37