SimpleSearch - Line and FST details


Line specific information

 
Line ID 199F09
Vector Used pAC161
Line Availability available as T3 set from NASC (N419077)
Segregation Analysis 98:10:5
Confirmed for Hit At3g09090
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g09090

 
Sequence (A. th genome BLAST matches underlined) 
>70-K014764-022-199-F09-8409
CTGATCCATGTAGCATTTCCCGGACATGAAATACTTTTGATTGACATAACCATCATATGT
GATACTTTCTCAATGATAAAAGTGTCTAACATTCTTTTGCTTCTGAAGTATAATGGAACC
AACAATAATAATATGATACTAATACTAAAAGATNTACAACATTCCTAAGTACTATTGCTA
TGGGATCCTCCCTATAAGTGAG
GenBank Accession AL760589 [GenBank]
Graphic View Graphic view of gene At3g09090
Predicted Position of Insertion Chr3:2787996 - go to primer design
BLAST e Value 8e-58
Hit Clone Code (BAC ID) MZB10
Hit Gene Code At3g09090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation defective in exine formation protein (DEX1)
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL760589 [GenBank]


Last Updated on 10.06.2021 13:37