SimpleSearch - Line and FST details


Line specific information

 
Line ID 199G03
Vector Used pAC161
Line Availability available as T3 set from NASC (N2023701)
Segregation Analysis N/A (line seemingly not resistant, T2 plants grown without drug)
Confirmed for Hit At4g26488
Parent of DUPLO pair 11652
Parent of pair(s) none

Gene hit At4g26490

 
Sequence (A. th genome BLAST matches underlined) 
>23-K014765-022-199-G03-8409
GGGATCCTCACTATATTGAGCTTTAACCATAACCATTACACATAACGTCAATGGCTTCAT
GTCCAAACCCCATTTACAATGAAGCCAATGTAGATTTTCCAGTCTTCATGTATATTCAAT
TGAACCTTTGTTTGAAGCGAGAGCTTGGGCAAAGAAGAGAGCTTTTGCATAATGGGGTTT
GGCTTTTGTTATGAGTGGGACCATGCGTGTCGTTTTGAAAACTATA
GenBank Accession AL760592 [GenBank]
Graphic View Graphic view of gene At4g26490
Predicted Position of Insertion Chr4:13380454 - go to primer design
BLAST e Value 3e-29
Hit Clone Code (BAC ID) M3E9
Hit Gene Code At4g26490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR805626 [GenBank]


Last Updated on 10.06.2021 13:37