SimpleSearch - Line and FST details


Line specific information

 
Line ID 200G05
Vector Used pAC161
Line Availability available as T3 set from NASC (N419181)
Segregation Analysis 50:27:21
Confirmed for Hit At1g66740
Parent of DUPLO pair 507
Parent of pair(s) none

Gene hit At1g66740

 
Sequence (A. th genome BLAST matches underlined) 
>39-K014487-022-200-G05-8409
ATGTAGCATTTCCCGAACATATGTTACCTGAATACAAAGCGGTAGTTGCCAACATTAACA
GGCCCTACAAGCACACTCACTATGGGATCCTCCCTATAGTGAGA
GenBank Accession AL760661 [GenBank]
Graphic View Graphic view of gene At1g66740
Predicted Position of Insertion Chr1:24893119 - go to primer design
BLAST e Value 5e-22
Hit Clone Code (BAC ID) F4N21
Hit Gene Code At1g66740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ASF1 like histone chaperone
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR934931 [GenBank] AL760661 [GenBank]


Last Updated on 10.06.2021 13:37