SimpleSearch - Line and FST details


Line specific information

 
Line ID 200H02
Vector Used pAC161
Line Availability available as T3 set from NASC (N419190)
Segregation Analysis 50:7:5
Confirmed for Hit At4g18550
Parent of DUPLO pair none
Parent of pair(s) 7028, 83505

Gene hit At4g18550

 
Sequence (A. th genome BLAST matches underlined) 
>16-K028790-022-200-H02-8409
ATGTCACCAATCGAAGTAAAATAAATATTTATTTCTTAGCAAAACTAAAGGGAGAAGGTA
TGGGATCCTCCCTATAGTGAGACCTATTGCTCATTCCTCTTTCTTTTTCTCCCTATTGAC
ATTCCTGCTGATTGCTGAGGGGTGTAGATT
GenBank Accession CR934939 [GenBank]
Graphic View Graphic view of gene At4g18550
Predicted Position of Insertion Chr4:10226296 - go to primer design
BLAST e Value 8e-26
Hit Clone Code (BAC ID) F28J12
Hit Gene Code At4g18550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR934939 [GenBank]


Last Updated on 10.06.2021 13:37