SimpleSearch - Line and FST details


Line specific information

 
Line ID 207E06
Vector Used pAC161
Line Availability available as T3 set from NASC (N419830)
Segregation Analysis 50:34:28
Confirmed for Hit At2g13650
Parent of DUPLO pair none
Parent of pair(s) 12647

Gene hit At2g13650

 
Sequence (A. th genome BLAST matches underlined) 
>45-K014553-022-207-E06-8409
TTGATCCATTGTAGATTTCCCGGNACATGAAGCCTTTACAATTGAATATATCCTGAAGAG
TATGCTTGCTGAGTTCTGCAAACTGGTCGGTACATTGAAAAGAACGATCCCCGCGATGGA
TAGAGGTATCTTGTTTAGAGATCCCACCAGGCTATGATTTTGAATAAAGCGAAAGATGTA
CCTATGGGATCCTCCCTTNAGTGAG
GenBank Accession AL761315 [GenBank]
Graphic View Graphic view of gene At2g13650
Predicted Position of Insertion Chr2:5687740 - go to primer design
BLAST e Value 2e-64
Hit Clone Code (BAC ID) T10F5
Hit Gene Code At2g13650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation golgi nucleotide sugar transporter 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR805762 [GenBank]


Last Updated on 10.06.2021 13:37