SimpleSearch - Line and FST details


Line specific information

 
Line ID 208D03
Vector Used pAC161
Line Availability available as T3 set from NASC (N419911)
Segregation Analysis 50:41:35
Confirmed for Hit At3g16180
Parent of DUPLO pair 2699
Parent of pair(s) none

Gene hit At3g16180

 
Sequence (A. th genome BLAST matches underlined) 
>20-K014551-022-208-D03-8409
TTGATCCATGTTAGATTTCCCGGACATGAAGCACTTTACAATTGAATACAAGCACGATAT
TTCACCCAAATCAACTTAAACCGAAACTTTCGGTTTAGATTCCCAATTTTAATAAAACTC
AACCTTTACTGACAGTAAACATAAACAAAGCATTTCCAAACCAAAGGCTAGCTATGGGAT
CCTCCCTATAGTGAG
GenBank Accession AL766178 [GenBank]
Graphic View Graphic view of gene At3g16180
Predicted Position of Insertion Chr3:5484302 - go to primer design
BLAST e Value 3e-66
Hit Clone Code (BAC ID) MSL1
Hit Gene Code At3g16180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Major facilitator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37