SimpleSearch - Line and FST details


Line specific information

 
Line ID 209G07
Vector Used pAC161
Line Availability available as T3 set from NASC (N420047)
Segregation Analysis 100:89:67
Confirmed for Hit At4g30935
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g30935

 
Sequence (A. th genome BLAST matches underlined)
>55-K014557-022-209-G07-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATAAAACGCAG
CGTTTTCTTCCGGAGATCAGTCGGTCGGAAAGCGGCTACCTTTTTGTCTGCCTATGGGAT
CCTCCCTATAGTGAG
GenBank Accession BX285297 [GenBank]
Graphic View Graphic view of gene At4g30935
Predicted Position of Insertion Chr4:15054053 - go to primer design
BLAST e Value 2e-27
Hit Clone Code (BAC ID) F6I18
Hit Gene Code At4g30935 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 32
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37