SimpleSearch - Line and FST details


Line specific information

 
Line ID 210G09
Vector Used pAC161
Line Availability available as T3 set from NASC (N420145)
Segregation Analysis 50:29:21
Confirmed for Hit At1g34180
Parent of DUPLO pair none
Parent of pair(s) 9541

Gene hit At1g34180

 
Sequence (A. th genome BLAST matches underlined) 
>71-K014135-022-210-G09-8409
TTGATCATGTAGATTTCCCGGACTGAAGCACTTACACTTGAATTATCCTCTATATCATAT
GTCCGTATTACAAAGTATCAGTAAAAAAGGCCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL766438 [GenBank]
Graphic View Graphic view of gene At1g34180
Predicted Position of Insertion Chr1:12450754 - go to primer design
BLAST e Value 3e-05
Hit Clone Code (BAC ID) F12G12
Hit Gene Code At1g34180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 16
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37