SimpleSearch - Line and FST details


Line specific information

 
Line ID 212D04
Vector Used pAC161
Line Availability available as T3 set from NASC (N420296)
Segregation Analysis 100:99:71
Confirmed for Hit At5g45970
Parent of DUPLO pair none
Parent of pair(s) 5792, 5797, 5803, 5815, 7659, 81922, 81925, 81928, 81929, 81930

Gene hit At5g45970

 
Sequence (A. th genome BLAST matches underlined) 
>28-K014133-022-212-D04-8409
TTTTGATCCATGTAGAATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGCCA
GTTACGAGAATATTCACAAAAAGGTAACTTTAAAAGTTTTTCCGTCCGTTTTTTTTTATA
GATAAGAAACTATGATTATATGATAAAGTATTTCTATGGGATCCTCC
GenBank Accession AL766619 [GenBank]
Graphic View Graphic view of gene At5g45970
Predicted Position of Insertion Chr5:18644437 - go to primer design
BLAST e Value 6e-31
Hit Clone Code (BAC ID) K15I22
Hit Gene Code At5g45970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RAC-like 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37