SimpleSearch - Line and FST details
Line specific information
Line ID | 216H03 |
Vector Used | pAC161 |
Line Availability | available as T3 set from NASC (N420727) |
Segregation Analysis | 50:42:31 |
Confirmed for Hit | At5g43285 |
Parent of DUPLO pair | none |
Parent of pair(s) | 92137, 92167, 92179, 92182, 92183 |
Gene hit At5g43285
Sequence (A. th genome BLAST matches underlined) | >24-K014145-022-216-H03-8409 GAGAAAGGATATATTCTCTCTTCTTCACTATGGGATCCTCCCTATAGTGAG |
GenBank Accession | AL767149 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr5:17370630 - go to primer design |
BLAST e Value | 2e-06 |
Hit Clone Code (BAC ID) | MNL12 |
Hit Gene Code | At5g43285 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | Putative membrane lipoprotein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Other FSTs Supporting this Hit | AL767149 [GenBank] |
Last Updated on 10.06.2021 13:37 |