SimpleSearch - Line and FST details
Line specific information
| Line ID | 216H03 |
| Vector Used | pAC161 |
| Line Availability | available as T3 set from NASC (N420727) |
| Segregation Analysis | 50:42:31 |
| Confirmed for Hit | At5g43285 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 92137, 92167, 92179, 92182, 92183 |
Gene hit At5g43285
| Sequence (A. th genome BLAST matches underlined) | >24-K014145-022-216-H03-8409 GAGAAAGGATATATTCTCTCTTCTTCACTATGGGATCCTCCCTATAGTGAG |
| GenBank Accession | AL767149 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr5:17370630 - go to primer design |
| BLAST e Value | 2e-06 |
| Hit Clone Code (BAC ID) | MNL12 |
| Hit Gene Code | At5g43285 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Putative membrane lipoprotein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | AL767149 [GenBank] |
|
Last Updated on 10.06.2021 13:37 |
gabi-kat.de 
