SimpleSearch - Line and FST details


Line specific information

 
Line ID 228E12
Vector Used pAC161
Line Availability available as T3 set from NASC (N421852)
Segregation Analysis 50:7:5
Confirmed for Hit At3g56760
Parent of DUPLO pair none
Parent of pair(s) 96806, 96810, 96814, 96817, 96819, 96821, 96822

Gene hit At3g56760

 
Sequence (A. th genome BLAST matches underlined) 
>93-K014267-022-228-E12-8409
TTTTTTCTTTTGTTTCTTTTTTCAATCTTTAATCTAATTCTCTTCTACGCTTTCTGCAAT
GTACGAGAGGAGACGCCGTGTAAGAGTCTGACAAAACCCAAGAAACTTAGCTTCCCATCA
GAATGTCTTATCCAATCTTGAAGAACAACATGAACAGGCACCGATGGACCTATGGGATCC
TCCCTATAGTGAG
GenBank Accession AL761816 [GenBank]
Graphic View Graphic view of gene At3g56760
Predicted Position of Insertion Chr3:21020672 - go to primer design
BLAST e Value 1e-59
Hit Clone Code (BAC ID) T8M16
Hit Gene Code At3g56760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL761815 [GenBank]


Last Updated on 10.06.2021 13:37