SimpleSearch - Line and FST details


Line specific information

 
Line ID 231H01
Vector Used pAC161
Line Availability available as T3 set from NASC (N422165)
Segregation Analysis 54:43:31
Confirmed for Hit At1g09970
Parent of DUPLO pair none
Parent of pair(s) 2796, 69349

Gene hit At1g09970

 
Sequence (A. th genome BLAST matches underlined) 
>08-K014313-022-231-H01-8409
TGATCCATGTAGATTTCCCGGAAATCTCCAATTCCGAAGCTCCGTCAAATCTCCAATCGC
CGGTGGAATTTTTCCGGCGATACTGCAATTCGACAAGTAAAGCCACGAGAGTTTCTTCAG
AGAAACAACCTCCACCGGGAAATCAGCCGTCGCATCAAACGGATTATCGCCTATGGGATC
CTCCCTATAGTGAGA
GenBank Accession AL938020 [GenBank]
Graphic View Graphic view of gene At1g09970
Predicted Position of Insertion Chr1:3253089 - go to primer design
BLAST e Value 4e-78
Hit Clone Code (BAC ID) F21M12
Hit Gene Code At1g09970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich receptor-like protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL938021 [GenBank]


Last Updated on 10.06.2021 13:37