SimpleSearch - Line and FST details
Line specific information
| Line ID | 233G02 |
| Vector Used | pAC161 |
| Line Availability | available as T3 set from NASC (N422346) |
| Segregation Analysis | 50:13:11 |
| Confirmed for Hit | At2g18150 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 75956, 76036, 76071, 76109, 76179, 76213, 76276, 76337, 76364, 76500, 76524, 76545, 76565, 76585, 76604, 76605, 76606, 76610, 76611, 76612, 76614, 76616 |
Gene hit At2g18150
| Sequence (A. th genome BLAST matches underlined) | >15-K014315-022-233-G02-8409 GATGCGGCTTAACGCTAAACTTATTGAGCAAGGGCCTTAAAAAAAACCTCTCTAGGG |
| GenBank Accession | AL938272 [GenBank] |
| Graphic View |
|
| Predicted Position of Insertion | Chr2:7893200 - go to primer design |
| BLAST e Value | 7e-11 |
| Hit Clone Code (BAC ID) | F8D23 |
| Hit Gene Code | At2g18150 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Peroxidase superfamily protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | AL938273 [GenBank] |
|
Last Updated on 10.06.2021 13:37 |




gabi-kat.de 
