SimpleSearch - Line and FST details


Line specific information

 
Line ID 233G02
Vector Used pAC161
Line Availability available as T3 set from NASC (N422346)
Segregation Analysis 50:13:11
Confirmed for Hit At2g18150
Parent of DUPLO pair none
Parent of pair(s) 75956, 76036, 76071, 76109, 76179, 76213, 76276, 76337, 76364, 76500, 76524, 76545, 76565, 76585, 76604, 76605, 76606, 76610, 76611, 76612, 76614, 76616

Gene hit At2g18150

 
Sequence (A. th genome BLAST matches underlined) 
>15-K014315-022-233-G02-8409
GATGCGGCTTAACGCTAAACTTATTGAGCAAGGGCCTTAAAAAAAACCTCTCTAGGG
GenBank Accession AL938272 [GenBank]
Graphic View Graphic view of gene At2g18150
Predicted Position of Insertion Chr2:7893200 - go to primer design
BLAST e Value 7e-11
Hit Clone Code (BAC ID) F8D23
Hit Gene Code At2g18150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Peroxidase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL938273 [GenBank]


Last Updated on 10.06.2021 13:37