SimpleSearch - Line and FST details


Line specific information

 
Line ID 234E05
Vector Used pAC161
Line Availability available as T3 set from NASC (N422421)
Segregation Analysis 50:10:7
Confirmed for Hit At5g07670
Parent of DUPLO pair none
Parent of pair(s) 40965, 83652

Gene hit At5g07670

 
Sequence (A. th genome BLAST matches underlined) 
>37-K014333-022-234-E05-8409
ATTTTGATCCATGTAGATTCTGCCGGGACATGAAGCTCGTCTACAATGGAATACTATAGA
TGACCCATGGTGATGAAGCGGCTTGCTCGTAGATATCTTGATGGCGAAACTGGACTACTC
TACTTCCTCGTATTATACGACATGATGCCCCACATTCTCCGTCAACGCTTCTTGAAGGTT
TTTTCTCGGCCTTGATTTTCCCGAGAAAGAGCTTTAACGGATTTCTGCAATACAAATGGA
AAGTTTGAAGCTTTGAGGAACTATGGGATTCTCACTATAAATATGATTGAAAA
GenBank Accession AL938376 [GenBank]
Graphic View Graphic view of gene At5g07670
Predicted Position of Insertion Chr5:2430505 - go to primer design
BLAST e Value 3e-63
Hit Clone Code (BAC ID) MBK20
Hit Gene Code At5g07670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNI-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL938376 [GenBank]


Last Updated on 10.06.2021 13:37