SimpleSearch - Line and FST details


Line specific information

 
Line ID 239B09
Vector Used pAC161
Line Availability available as T3 set from NASC (N422869)
Segregation Analysis 100:71:53
Confirmed for Hit At1g01720
Parent of DUPLO pair none
Parent of pair(s) 2333, 97158

Gene hit At1g01720

 
Sequence (A. th genome BLAST matches underlined) 
>66-K014365-022-239-B09-8409
GTGGAAAGATAGGTCGGAGCGTATGGGATGACAATATCTTTATGCCTTGATTTTGGGTTT
AATTACAGTTGATGCCACCGTGGATAACGCGTATGGAGGACGAGGGAGTATTAATCAGAT
GTTTCCGCTACAGGATATGTTCATGTACATGCAGAAGCCTTGCTATGGGATCCTCCCTAT
AGTGAG
GenBank Accession BX649794 [GenBank]
Graphic View Graphic view of gene At1g01720
Predicted Position of Insertion Chr1:269332 - go to primer design
BLAST e Value 1e-47
Hit Clone Code (BAC ID) T1N6
Hit Gene Code At1g01720 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC (No Apical Meristem) domain transcriptional regulator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX649794 [GenBank]


Last Updated on 10.06.2021 13:37