SimpleSearch - Line and FST details


Line specific information

 
Line ID 240B10
Vector Used pAC161
Line Availability available as T3 set from NASC (N422966)
Segregation Analysis N/A (line seemingly not resistant, T2 plants grown without drug)
Confirmed for Hit At5g11200
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g11200

 
Sequence (A. th genome BLAST matches underlined)
>74-K014366-022-240-B10-8409
CTGATCCATGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATACGTAATGATATCG
ATACTTATATATAGCAGGGAGACTGGATAGGGTTGAGAATGGGCTTTATCTTTAATGGG
GenBank Accession AL939007 [GenBank]
Graphic View Graphic view of gene At5g11200
Predicted Position of Insertion Chr5:3567156 - go to primer design
BLAST e Value 2e-12
Hit Clone Code (BAC ID) F2I11
Hit Gene Code At5g11200 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DEAD/DEAH box RNA helicase family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL939007 [GenBank]


Last Updated on 10.06.2021 13:37