SimpleSearch - Line and FST details
Line specific information
Line ID | 241A07 |
Vector Used | pAC161 |
Line Availability | available as T3 set from NASC (N423047) |
Segregation Analysis | 66:21:21 |
Confirmed for Hit | At1g06620 |
Parent of DUPLO pair | none |
Parent of pair(s) | 5372, 5386, 7549, 7553, 10274, 10294, 10329, 10967, 95805, 95836, 95837, 95838, 95839, 95840, 95841 |
Gene hit At1g06620
Sequence (A. th genome BLAST matches underlined) | >49-K014367-022-241-A07-8409 GATCCAAAGTGTATCTCTTCCAATTCGCCGCCGTGAGCTAAACAGATCGAAGTTGCTGCT |
GenBank Accession | AL939085 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr1:2026085 - go to primer design |
BLAST e Value | 4e-13 |
Hit Clone Code (BAC ID) | F12K11 |
Hit Gene Code | At1g06620 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on 10.06.2021 13:37 |