SimpleSearch - Line and FST details


Line specific information

 
Line ID 243E10
Vector Used pAC161
Line Availability available as T3 set from NASC (N423290)
Segregation Analysis 50:16:13
Confirmed for Hit At1g11960
Parent of DUPLO pair none
Parent of pair(s) 84769, 84770, 84772, 84775, 84778, 84779, 84780

Gene hit At1g11960

 
Sequence (A. th genome BLAST matches underlined) 
>77-K014389-022-243-E10-8409
TTCTGATCCATGTAGCATTTCCTCGAGCATGAAGCATTTACAATTGAATATTAGCCTAAG
TTAATTAGGGCAACTTGCTGACNTAATCACCTGACTGCAAAGGGCTGCTTCTTATACCTT
TGAGATCCATTTATGGAAATAAACCCTATCGTTGAATGGTTGAATCCTCAAGATTGCAAA
TGCCAAAAGGAAGATGATTGCAGTGAGTATGTTGATTGCTGCTGCTACTCCAATATCTCC
TAGGGG
GenBank Accession AL940000 [GenBank]
Graphic View Graphic view of gene At1g11960
Predicted Position of Insertion Chr1:4042949 - go to primer design
BLAST e Value 2e-74
Hit Clone Code (BAC ID) F12F1
Hit Gene Code At1g11960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ERD (early-responsive to dehydration stress) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL940000 [GenBank]


Last Updated on 10.06.2021 13:37