SimpleSearch - Line and FST details


Line specific information

 
Line ID 245B08
Vector Used pAC161
Line Availability available as T3 set from NASC (N423444)
Segregation Analysis 50:25:16
Confirmed for Hit At5g17060
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g17060

 
Sequence (A. th genome BLAST matches underlined) 
>58-K014398-022-245-B08-8409
AATTTCCTGGACCGAGGGTATGATACTGCCTATGGGATCCTCCCTATATATGATGAGTCC
TGAAATCCTTTGGACCGCCACTCGTAAAATTATTTCCCTTCAATTTCTCTGAAATCTATT
CACCGTCTCCTTTGTCTCCTCCTCCAAATCGATCGTTCCTCGTCGTCGTCTGATTTTCTC
TACGATTGCTTTTTCTGCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL940180 [GenBank]
Graphic View Graphic view of gene At5g17060
Predicted Position of Insertion Chr5:5610839 - go to primer design
BLAST e Value 1e-68
Hit Clone Code (BAC ID) F2K13
Hit Gene Code At5g17060 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ADP-ribosylation factor B1B
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL940179 [GenBank]


Last Updated on 10.06.2021 13:37