SimpleSearch - Line and FST details


Line specific information

 
Line ID 245H11
Vector Used pAC161
Line Availability available as T3 set from NASC (N423519)
Segregation Analysis 50:23:14
Confirmed for Hit At2g40095
Parent of DUPLO pair 12740
Parent of pair(s) none

Gene hit At2g40095

 
Sequence (A. th genome BLAST matches underlined) 
>88-K014398-022-245-H11-8409
CTGATCCATGTAGCATTTCCCGCACATGAANGCCTTTACAATTGAATATATCCTGAATAT
ATCTCTGACTCTGACCCATTGCAGATTAAAAATCTAATTCATTCCTATAGGATCCTCCCT
ATAGTGAGAGG
GenBank Accession AL940270 [GenBank]
Graphic View Graphic view of gene At2g40095
Predicted Position of Insertion Chr2:16743960 - go to primer design
BLAST e Value 5e-16
Hit Clone Code (BAC ID) F27I1
Hit Gene Code At2g40095 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Alpha/beta hydrolase related protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37