SimpleSearch - Line and FST details


Line specific information

 
Line ID 250F04
Vector Used pAC161
Line Availability available as T3 set from NASC (N423968)
Segregation Analysis 50:20:17
Confirmed for Hit At2g44790
Parent of DUPLO pair none
Parent of pair(s) 94751

Gene hit At2g44790

 
Sequence (A. th genome BLAST matches underlined) 
>30-K014490-022-250-F04-8409
TGATCCATGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATTATCCATGATGTTTT
ATCGCCCGGGACAATGGTCAAAACTATGGGATCC
GenBank Accession FR806500 [GenBank]
Graphic View Graphic view of gene At2g44790
Predicted Position of Insertion Chr2:18463150 - go to primer design
BLAST e Value 0.097
Hit Clone Code (BAC ID) F16B22
Hit Gene Code At2g44790 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation uclacyanin 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR806500 [GenBank]


Last Updated on 10.06.2021 13:37