SimpleSearch - Line and FST details


Line specific information

 
Line ID 260E01
Vector Used pAC161
Line Availability available as T3 set from NASC (N424913)
Segregation Analysis 50:25:21
Confirmed for Hit At5g36690
Parent of DUPLO pair none
Parent of pair(s) 69659, 97636

Gene hit At5g36690

 
Sequence (A. th genome BLAST matches underlined) 
>05-K014949-022-260-E01-8409
TATAACTATCGCTCTCACCAGACCAAAACACTTTTACAGTCAGAAAACCTAACCGAATTT
TAACGAATGGTTAGATAAAACAGTTGTATTACAAGATGATCAAGTTCCTCCTTTGTAAAA
CAAAGTTGATCACTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL941747 [GenBank]
Graphic View Graphic view of gene At5g36690
Predicted Position of Insertion Chr5:14416661 - go to primer design
BLAST e Value 7e-52
Hit Clone Code (BAC ID) F24C7
Hit Gene Code At5g36690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation proton pump-interactor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL941747 [GenBank]


Last Updated on 10.06.2021 13:37