SimpleSearch - Line and FST details


Line specific information

 
Line ID 263D04
Vector Used pAC161
Line Availability available as T3 set from NASC (N425192)
Segregation Analysis 50:31:23
Confirmed for Hit At3g20820
Parent of DUPLO pair none
Parent of pair(s) 7033, 9658

Gene hit At3g20820

 
Sequence (A. th genome BLAST matches underlined) 
>28-K014952-022-263-D04-8409
ACGATGGCCTTTCAGGTATCTTCCCTTGTAACAAGTTCCGGCTCAAATTCAGATTCATCA
CCGACGACGTCATCAGAGTTTGAGGTATCTCGCCGGAGATTTTGTTTCCGTCGAGGTTAA
GTGTGGCTATGGGATCCTCCCATGNAGTGAGATGAAGCGACTATAG
GenBank Accession AL942111 [GenBank]
Graphic View Graphic view of gene At3g20820
Predicted Position of Insertion Chr3:7281793 - go to primer design
BLAST e Value 2e-58
Hit Clone Code (BAC ID) MOE17
Hit Gene Code At3g20820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat (LRR) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL942110 [GenBank]


Last Updated on 10.06.2021 13:37