SimpleSearch - Line and FST details


Line specific information

 
Line ID 270A10
Vector Used pAC161
Line Availability available as T3 set from NASC (N425834)
Segregation Analysis 50:16:11
Confirmed for Hit At1g09490
Parent of DUPLO pair none
Parent of pair(s) 87578, 87589, 87614, 87620, 87625, 87630, 87637, 87638, 87640

Gene hit At1g09490

 
Sequence (A. th genome BLAST matches underlined) 
>73-K015070-022-270-A10-8409
CTGATCCATGGTAGATTTCCCGGGACATGAAGCACTATCAAAGCGTTGGAGACTCCTTCA
GCCAATGGCAGATACATCATCGATGGTCCAAATATGAGTGTAAACGACATTATAGACATT
CTTCGGAAGCTGTTCCCAGATTTGTCTATTGCTGATACGTGAGATCTCTTTCCCTATGGG
ATCCTCCCTTAAGTGAG
GenBank Accession AL942905 [GenBank]
Graphic View Graphic view of gene At1g09490
Predicted Position of Insertion Chr1:3065453 - go to primer design
BLAST e Value 6e-74
Hit Clone Code (BAC ID) F14J9
Hit Gene Code At1g09490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD(P)-binding Rossmann-fold superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL942905 [GenBank]


Last Updated on 10.06.2021 13:37