SimpleSearch - Line and FST details


Line specific information

 
Line ID 271G03
Vector Used pAC161
Line Availability available as T3 set from NASC (N425995)
Segregation Analysis 50:24:15
Confirmed for Hit At3g30340
Parent of DUPLO pair none
Parent of pair(s) 9155

Gene hit At3g30340

 
Sequence (A. th genome BLAST matches underlined)
>23-K015064-022-271-G03-8409
TGATCCATGTAGATTTCCCGGGACATGAGCCATTACACTTGACATATTCAAATATCTATT
GACTATAGCATCCTCCTATAGTGAGAG
GenBank Accession FR806958 [GenBank]
Graphic View Graphic view of gene At3g30340
Predicted Position of Insertion Chr3:11958425 - go to primer design
BLAST e Value 4e-04
Hit Clone Code (BAC ID) T6J22
Hit Gene Code At3g30340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nodulin MtN21 /EamA-like transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37