SimpleSearch - Line and FST details


Line specific information

 
Line ID 272G09
Vector Used pAC161
Line Availability available as T3 set from NASC (N426097)
Segregation Analysis 50:50:39
Confirmed for Hit At3g12020
Parent of DUPLO pair 2644
Parent of pair(s) none

Gene hit At3g12020

 
Sequence (A. th genome BLAST matches underlined)
>71-K015096-022-272-G09-8409
AGCATTTGAGATAAGCTGAAGTAACCTGGGTTTGTTGTTTTTGGCTTATAACGTGATGAT
AAAAGCTAGGACCTGGTTCGAGAGACGCG
GenBank Accession AL943238 [GenBank]
Graphic View Graphic view of gene At3g12020
Predicted Position of Insertion Chr3:3831403 - go to primer design
BLAST e Value 5e-22
Hit Clone Code (BAC ID) MEC18
Hit Gene Code At3g12020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL943238 [GenBank]


Last Updated on 10.06.2021 13:37