SimpleSearch - Line and FST details


Line specific information

 
Line ID 277B05
Vector Used pAC161
Line Availability available as T3 set from NASC (N426513)
Segregation Analysis 50:47:33
Confirmed for Hit At5g44990
Parent of DUPLO pair none
Parent of pair(s) 9721

Gene hit At5g44990

 
Sequence (A. th genome BLAST matches underlined)
>34-K015121-022-277-B05-8409
GATTTCCCGACATGAAGCACTTTACAATTGAACAAAATAAGACTTAAGATTAGACCACAC
CATGATTAAAAGAACTTACAGGAACCGTATATTTGCCCGTGTAGTTGGAGCTATGGGATC
CTCCCTATAGTGAGA
GenBank Accession AL943802 [GenBank]
Graphic View Graphic view of gene At5g44990
Predicted Position of Insertion Chr5:18163865 - go to primer design
BLAST e Value 3e-39
Hit Clone Code (BAC ID) K21C13
Hit Gene Code At5g44990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Glutathione S-transferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37